Cortexifan website & red-yellow-blue
Cortexifan | Theories & Speculation | Viral/ARG | Posted by ScullyIf anyone read the material Di found on the Rinri Project and The Thirteen Moons In Motion and how it related to the red-yellow-blue pattern that has had us chasing our tails, there is something new I would like to add. Below is a picture of Jose’ Arguelles‘ wheel, based on his 13 month calendar.
.
I studied this wheel closely, looking for something to connect it to Fringe, but I didn’t find anything. Then the other day, I was revisiting the, probably fake, Cortexifan website, just to see if anything had changed. It has, the main page is different and there are several links. Mostly they loop around, and lead to fake advertising, but that’s not what interested me. On the main page, down at the bottom, the symbols where the links are looked familiar…
.
The information states that the line means ‘5′ and each dot means ‘1′. So these would be variations of ‘6′ and ‘7′. I’m not sure what it means. Anyone?
.
Please forgive me if these symbols have actual meaning, not related to Fringe. I am not that internet or computer savvy and I am probably stretching the limits here, but they did seem rather similar.
.
I am also curious about the number just above that...FC167FE1AB2E0A9796F9E4D155B44EA6998F4871. For those who are interested, if you click on the first symbol, then go to the address bar and type in ‘cortexifan’ after the last backslash, it takes you to a document page with contains the original list. It’s a little different. Now it looks like this…
.
X-KR-COR235996 TS01PB80P 0 X-KR-COR235996 TS02CD81N 0 X-KR-COR235996 TS03AA81N 0 X-KR-COR235996 TS04MR81N 0 X-KR-COR235996 TS05MC81N 0 X-KR-COR235996 TS06DO81N 0 X-KR-COR235996 TS07FR81N 0 X-KR-COR235996 TS08TT81N 0
.
We know COR would be cortexiphan, TS08 is test subject #8, TT initials of test subject, 81 would be the year they were tested on, and N or P means positive or negative. But what is KR?
.
UPDATE:
.
There has been some new links added since earlier today when I wrote this post. Now there is an additional document with the following test results…note they are all positive.
.
X-KR-COR236000 TS46LN83P 1 X-KR-COR236000 TS47OT83P 0 X-KR-COR236000 TS48TN83P 1 X-KR-COR236000 TS49AR83P 1 X-KR-COR236000 TS50SM83P 1 X-KR-COR236000 TS51SO83P 0
X-KR-COR236000 TS52UR84P 1
.
The other added link takes you to a page that reads…”Chimera – A hybridoma life form with a mixture of genetic material from multiple species. Typically seen in animals, but also rarely seen in human beings. See: Project Gryphon and Cacatrice.“







May 5th, 2009 at 5:12 pm
./ /. and similar are ways of refering to what directory you are referencing in a file structure, and are used in websites sometimes. Could be coincidence.
May 5th, 2009 at 5:17 pm
I figured they probably had some meaning in real life…it was worth a shot.
May 5th, 2009 at 5:18 pm
i was trying to make some sense into the connection with the colors, that are apparently very important..but i got lost on the gibberish and drifted. on the big picture it seemed some things fit, not on actual detail but on the context..but i can’t really pinpoint anything particular without feeling like i’d be stretching it too thin. If red, yellow and blue end up being J.J.’s favorite colors, i’ll be very pissed! lol
♥
May 5th, 2009 at 5:25 pm
No kidding…but it’s fun to try and figure it out, regardless.
May 5th, 2009 at 10:06 pm
“For those who are interested, if you click on the first symbol, then go to the address bar and type in ‘cortexifan’ after the last backslash, it takes you to a document page with contains the original list.”
You can do that with more of the links.
the first and the second one. The first comes up with two links. one with 7 positives only (these tests are done in 83 and 84), and the link with four positives and a bunch of negs(done in 80-83).
May 5th, 2009 at 10:07 pm
http://www.cortexifan.com/Secure/Projects/Cortexifan/CORTEXIFAN.1.TXT
and
http://www.cortexifan.com/Secure/Projects/Cortexifan/CORTEXIFAN.2.txt
May 5th, 2009 at 10:18 pm
No way…back I go to…holy crap…there’s a fourth link added since I was there a few hours ago. I will check it out and update.
May 5th, 2009 at 10:46 pm
It would be very funny if the faker was reading this blog and messing with your mind, Scully.
(No, it’s not me)
May 5th, 2009 at 10:51 pm
So funny you said that, I had the same thought earlier, but darnit, you were my number 1 suspect.
May 5th, 2009 at 10:53 pm
nick lane doesn’t seem to be on there… he could be TS24RL (maybe nicks his middle name?) or TS46LN if they suddenly changed to last name first…
May 5th, 2009 at 10:59 pm
I thought that might be true as well…if the website is real. Walter said they were paired off and that Olivia and Nick would have a connection because of that.
But whose to say they don’t all have connections with each other, they are super human. They never actually stated that Nick was tested in Jacksonville, we just assume because of Walter. What if he was tested in Ohio? That would explain why his initials aren’t on the list.
May 5th, 2009 at 11:03 pm
true. Never thought of that, I assumed they were at the same location because Nick mentions that Olivia comforts him when he’s scared doesn’t he? or maybe it was Vice versa…
May 5th, 2009 at 11:06 pm
Nope, you’re right. So much for that theory.
May 5th, 2009 at 11:12 pm
I just realized, whoever is running this website has some serious problems spelling. They spelled ‘Gryphon’ wrong. Not their first mistake…
‘Treament’ ‘Gama’
May 5th, 2009 at 11:21 pm
I thought they said that he was in Jacksonville, isn’t that why Liv thought that he might be a C-phan kid?
May 5th, 2009 at 11:22 pm
ha,I thought it was that, but went with your spelling (I never trust my judgment when it comes to spelling).
May 5th, 2009 at 11:35 pm
true. Unless bad spelling is a clue of some sort too. haha. I would doubt that.
May 5th, 2009 at 11:45 pm
That’s what happens when you copy/paste. oops.
May 5th, 2009 at 11:52 pm
FC167FE1AB2E0A9796F9E4D155B44EA6998F4871
FC FE AB E A F E D B EA F
FCFEABEAFEDBEAF
1 67 1 2 0 9796 9 4 155 44 6998 4871
1671209796941554469984871
make any more sense this way to anyone?
May 5th, 2009 at 11:58 pm
The only letters are…ABCDE and F…that’s weird. I wish I had my decoder ring.
May 6th, 2009 at 12:33 am
http://www.observersarehere.com/wp-content/uploads/2009/01/bfringepromo7.jpg
There’s only a-f in this Fibonacci spiral diagram.
I feel like the sequence might just be a random sequence though.
May 6th, 2009 at 12:48 am
RSA TOKEN has some kind of meaning that has to do with cell phones or something.
http://wiki.answers.com/Q/What_is_the_meaning_of_RSA_in_case_of_RSA_token
and delta gamma four would be DC 4 or something… I dont knoww greek letters very well.
May 6th, 2009 at 4:15 am
It’s Hexadecimal, base 16. It’s like base 10, but the 10th-15th numerals are expressed by the first 6 letters.
I ran it through a hex to ascii converter but it’s nonsense. It’s basically a really huge number, which is what RSA uses to encrypt and decrypt information.
-Mike
May 7th, 2009 at 6:25 pm
Findings from website..
http://www.cortexifan.com/Secure/Projects/Cortexifan/CORTEXIFAN.1.TXT
http://www.cortexifan.com/Secure/Projects/Cortexifan/CORTEXIFAN.2.txt
http://www.cortexifan.com/Secure/Projects/MD/Chimera/Chimera.1.txt
http://www.cortexifan.com/Secure/Projects/MD/Chimera/Chimera.Gryphon.txt
Enjoy.
May 7th, 2009 at 6:28 pm
and some references for Gryphon text
http://en.wikipedia.org/wiki/Geep
http://en.wikipedia.org/wiki/Mosaic_Evolution
May 7th, 2009 at 6:29 pm
Oh, and still on. Try search “Cacatrice” from site. Text files, combinations, anything, as it is listed as a project.
May 7th, 2009 at 6:33 pm
I googled ‘Cacatrice’ and couldn’t find anything in English.I didn’t try adding that to the address bar though. I will check it out.
May 7th, 2009 at 6:43 pm
I checked it out…nothing with ‘Cacatrice’ but there was another file listed under chimera…
Gryphon-86
TGAAACGGAGGAGACGTTACAGCAACGT
TGAAATGGAGGAGAAATTACAGCAATTT
TGAAACGGAAGAGACGTTACAGCAACGT
sciref:geep
refproj:mockt
refproj:mosaic
Also, all of the listings on the ‘Error 404′ page are for sedoparking.com. This is more evidence that the website is fake. (but still interesting)
May 8th, 2009 at 3:09 am
How about “Cockatrice”
http://bestiary.ca/beasts/beast265.htm
http://en.wikipedia.org/wiki/Cockatrice
May 8th, 2009 at 6:49 am
I’m such a dork — cactrice should be Cockatrice … it’s a legendary creature like a griffin and whatnot.
You know, does the Fringe viewing world know for a fact that the cortexifan site is bogus? JJ has used misspellings before as purposeful clues. In the recent magazine Wired which he guest edited, he ladened the thing with all manners of puzzles, etc. One of the puzzles was an Edgar Alan Poe excerpt with intentional misspellings as part of the puzzle.
It would really be nice to know for sure whether or not this site is a total fraud or not. The multitude of misspellings though is almost too coincidental it would seem.
May 8th, 2009 at 1:29 pm
i went back to the site to double check if susan pratt [or her initials] could be found on any of the lists as a positive. but i found no SP. that would indicate that it isn’t real because the only initials that match are PB and OD, which we’ve known about [almost] from the get-to. But on defense of the cortexifan possible hoax, we never knew if susan pratt was her real name, as her twin sister had a very different last name. something that also doesn’t make too much sense is that the FBI database said that she’d disappeared 11 years ago, but from where? 11 years ago would leave her twin sister old enough to remember her, had she been with her. and not only remember, but be on the look-out for her, as they lived on the same area. Also both susan and her sister had successfully achieved normal lives with both her names [working, which i'd assume would imply real social security numbers and whatnot]. had she disappeared and been forced to change her identity, that would take a pro to bureaucratically re-build a life from scratch starting from the point of her disappearance, which would possibly also land her, possibly, on her teens..so who was helping her? that bit doesn’t make any sense.
♥
May 8th, 2009 at 7:55 pm
He’s intentionally misspelled things before?
That makes me think of SURGG and some of the early glyph words.
May 13th, 2009 at 8:58 pm
Um, why was my comment deleted?
May 14th, 2009 at 12:04 am
Reposting…
X-KR-COR235996 TS42OD83P 1 = Olivia?
Since you’ve caught on to the law of time calendar on the cortexifan site, check out http://www.lawoftime.org/content/ThirteenMoonsinMotion.pdf.
In the 13 moon calendar, the number 7 corresponds to the symbol for blue hand (also red blood/heart and transforming remembrance) which, in turn, corresponds to a large area of the pacific ocean. The blue hand knows accomplishment. The number 7 also corresponds to the resonant moon (brought by the resonant monkey) which occurs between January 10th and February 6th. The resonant moon is the moon of attunement: how can I attune my service to others? The galactic enzyme code for the hand is 7,1,8,2,9,3,10,4,11,5,12,6,13.
This belief system holds that time may be stopped by changing the calendar, and that, if we accomplish this, we will experience an “evolutionary upgrade” in the year 2012 and no longer be homo sapiens. It will be a new beginning, the “coming of heaven on Earth.” The number glyphs and the end of the world as we know it in 2012 are obviously concepts borrowed from the ancient Mayans.
On the frog on the cortexifan site, his leg is coded with C20H25N3, which is D-Lysergic Acid Diethylamide or LSD.
May 14th, 2009 at 1:53 am
i liked the 13 moon thing a lot. i got lost on the gibberish but it all made sense, and i could only fathom that they would include the ‘ending of the world’ [as we know it, as it doesn't mean actual disintegration] from the mayans. but all the esoteric stuff kinda threw me off. but the LSD makes total sense, as, as we know, walter and bell were very fond of it on earlier times.
♥
May 14th, 2009 at 2:26 am
@EPH! Do you know when the Cortexifan.com (note that this one is spelled correctly) Became active?
It doesn’t seem to hold any secrets… just a very simple layout.
May 14th, 2009 at 2:33 am
wait, nvm that. lol. that’s the incorrect one.
May 14th, 2009 at 2:40 am
the site seems to of given up though and just settled for the simple layout with the frog.
May 14th, 2009 at 10:59 am
Sorry eph: Your comment wasn’t deleted, it was waiting for approval because it had a link in it. I have to do this to avoid spam or the comment box would be filled with links to nude pictures of Pamela Anderson.
May 14th, 2009 at 12:57 pm
did someone notice that the cortexifan.com site changed?! it’s a black screen now with simple text, that reads:
“We own the site now.
Go elsewhere for your information.
You will find nothing here.”
that’d be a mock reference to MD i assume
♥
May 18th, 2009 at 11:47 pm
when you go to “view page source” it says
one is spelled correctly. just thought I’de point that out.
this is the date of its change: 2009-05-13
May 20th, 2009 at 11:34 am
..or perhaps a reference to ZFT?
♥
May 21st, 2009 at 12:52 am
something new on the site..a watermark on the lower left corner that when you hover over it, reads: ‘wbwashere’. how very great that both walter and william are wb’s, it could be anyone.
♥
May 21st, 2009 at 12:54 am
ok, not a watermark but a glowing frog that fades into a watermark and then glows back to full-blown frog
♥
May 21st, 2009 at 12:57 am
http://www.cortexifan.com/frog.gif
frog has a code on the hind leg..i know i’m posting too much but i keep on finding these things and i can’t erase the previous comments to just put everything together on one. if you guys think it could be of any relevance check it out, i’m officially dropping it now, i promise! lol
♥
May 21st, 2009 at 5:05 am
the frogs leg has C2OH25N30 on it. (i think.)
C2OH25N30- compound of D-Lysergic Acid Diethylamide.
in other words ( I belive )It’s LSD.
May 21st, 2009 at 1:09 pm
No way, that’s awesome work ariannejean. I was kind of disappointed that there was no link on that page…I thought the frog might take us somewhere else. Maybe later on they will add something else to it.
May 21st, 2009 at 1:11 pm
I dunno if this is new, but if you go to http://www.cortexifan.com, it says:
“We own the site now.
Go elsewhere for your information.
You will find nothing here.”
Creepy.
May 21st, 2009 at 1:12 pm
Oh… it was already found. >_< Duh.
May 21st, 2009 at 3:42 pm
@Andrew, on my comment on May 14th i pointed out that the msg had changed, but then, the frog wasn’t there. i went back yesterday to see if anything had changed and there was the smudge on the corner, than turned into a frog.
@ariannejean, i downloaded the set of imgs after that last post and extracted the code, but i said i wasn’t posting again, so i just let it roll
but yes, that is indeed LSD [see http://en.wikipedia.org/wiki/Lsd
♥
February 10th, 2010 at 6:34 am
Congratulations on your prolific work here. I must admit I have popped in a read a good number of your blogs but I have no idea how to post a response over there, so I’ll tell you now how good you are at describing the stuff your at - I must admit I find it insightful to read your blogging. Keep up the good work.