May 5, 2009

Cortexifan website & red-yellow-blue

Cortexifan | Theories & Speculation | Viral/ARG | Posted by Scully

If anyone read the material Di found on the Rinri Project and The Thirteen Moons In Motion and how it related to the red-yellow-blue pattern that has had us chasing our tails, there is something new I would like to add.  Below is a picture of Jose’ Arguelles‘ wheel, based on his 13 month calendar.

fringe_13_month_calendar

.

I studied this wheel closely, looking for something to connect it to Fringe, but I didn’t find anything.  Then the other day, I was revisiting the, probably fake, Cortexifan website, just to see if anything had changed.  It has, the main page is different and there are several links.  Mostly they loop around, and lead to fake advertising, but that’s not what interested me.  On the main page, down at the bottom, the symbols where the links are looked familiar…

fringe_cortexifan_2

.

The information states that the line means ‘5′ and each dot means ‘1′.  So these would be variations of ‘6′ and ‘7′.  I’m not sure what it means.  Anyone?

.

Please forgive me if these symbols have actual meaning, not related to Fringe.  I am not that internet or computer savvy and I am probably stretching the limits here, but they did seem rather similar.

.

I am also curious about the number just above that...FC167FE1AB2E0A9796F9E4D155B44EA6998F4871.  For those who are interested, if you click on the first symbol, then go to the address bar and type in ‘cortexifan’ after the last backslash, it takes you to a document page with contains the original list.  It’s a little different.  Now it looks like this…

.

X-KR-COR235996	TS01PB80P	0
X-KR-COR235996	TS02CD81N	0
X-KR-COR235996	TS03AA81N	0
X-KR-COR235996	TS04MR81N	0
X-KR-COR235996	TS05MC81N	0
X-KR-COR235996	TS06DO81N	0
X-KR-COR235996	TS07FR81N	0
X-KR-COR235996	TS08TT81N	0

.

We know COR would be cortexiphan, TS08 is test subject #8, TT initials of test subject, 81 would be the year they  were tested on, and N or P means positive or negative. But what is KR?

.

UPDATE:

.

There has been some new links added since earlier today when I wrote this post.  Now there is an additional document with the following test results…note they are all positive.

.

X-KR-COR236000	TS46LN83P	1
X-KR-COR236000	TS47OT83P	0
X-KR-COR236000	TS48TN83P	1
X-KR-COR236000	TS49AR83P	1
X-KR-COR236000	TS50SM83P	1
X-KR-COR236000	TS51SO83P	0
X-KR-COR236000	TS52UR84P	1

.

The other added link takes you to a page that reads…”Chimera – A hybridoma life form with a mixture of genetic material from multiple species. Typically seen in animals, but also rarely seen in human beings.  See: Project Gryphon and Cacatrice.

Share:
  • TwitThis
  • Facebook
  • del.icio.us
  • Google
  • Digg

51 Responses to “Cortexifan website & red-yellow-blue”

  1. pr3sidentspence

    ./ /. and similar are ways of refering to what directory you are referencing in a file structure, and are used in websites sometimes. Could be coincidence.

  2. Scully Scully

    I figured they probably had some meaning in real life…it was worth a shot.

  3. Di

    i was trying to make some sense into the connection with the colors, that are apparently very important..but i got lost on the gibberish and drifted. on the big picture it seemed some things fit, not on actual detail but on the context..but i can’t really pinpoint anything particular without feeling like i’d be stretching it too thin. If red, yellow and blue end up being J.J.’s favorite colors, i’ll be very pissed! lol

  4. Scully Scully

    No kidding…but it’s fun to try and figure it out, regardless.

  5. ariannejean

    “For those who are interested, if you click on the first symbol, then go to the address bar and type in ‘cortexifan’ after the last backslash, it takes you to a document page with contains the original list.”

    You can do that with more of the links.
    the first and the second one. The first comes up with two links. one with 7 positives only (these tests are done in 83 and 84), and the link with four positives and a bunch of negs(done in 80-83).

  6. Scully Scully

    No way…back I go to…holy crap…there’s a fourth link added since I was there a few hours ago. I will check it out and update.

  7. pr3sidentspence

    It would be very funny if the faker was reading this blog and messing with your mind, Scully.

    (No, it’s not me)

  8. Scully Scully

    So funny you said that, I had the same thought earlier, but darnit, you were my number 1 suspect. :)

  9. ariannejean

    nick lane doesn’t seem to be on there… he could be TS24RL (maybe nicks his middle name?) or TS46LN if they suddenly changed to last name first…

  10. Scully Scully

    I thought that might be true as well…if the website is real. Walter said they were paired off and that Olivia and Nick would have a connection because of that.

    But whose to say they don’t all have connections with each other, they are super human. They never actually stated that Nick was tested in Jacksonville, we just assume because of Walter. What if he was tested in Ohio? That would explain why his initials aren’t on the list.

  11. ariannejean

    true. Never thought of that, I assumed they were at the same location because Nick mentions that Olivia comforts him when he’s scared doesn’t he? or maybe it was Vice versa…

  12. Scully Scully

    Nope, you’re right. So much for that theory.

  13. Scully Scully

    I just realized, whoever is running this website has some serious problems spelling. They spelled ‘Gryphon’ wrong. Not their first mistake…
    ‘Treament’ ‘Gama’

  14. pr3sidentspence

    I thought they said that he was in Jacksonville, isn’t that why Liv thought that he might be a C-phan kid?

  15. pr3sidentspence

    ha,I thought it was that, but went with your spelling (I never trust my judgment when it comes to spelling).

  16. ariannejean

    true. Unless bad spelling is a clue of some sort too. haha. I would doubt that.

  17. Scully Scully

    That’s what happens when you copy/paste. oops.

  18. ariannejean

    FC167FE1AB2E0A9796F9E4D155B44EA6998F4871

    FC FE AB E A F E D B EA F
    FCFEABEAFEDBEAF

    1 67 1 2 0 9796 9 4 155 44 6998 4871
    1671209796941554469984871

    make any more sense this way to anyone?

  19. Scully Scully

    The only letters are…ABCDE and F…that’s weird. I wish I had my decoder ring.

  20. ariannejean

    http://www.observersarehere.com/wp-content/uploads/2009/01/bfringepromo7.jpg
    There’s only a-f in this Fibonacci spiral diagram.

    I feel like the sequence might just be a random sequence though.

  21. ariannejean

    RSA TOKEN has some kind of meaning that has to do with cell phones or something.

    http://wiki.answers.com/Q/What_is_the_meaning_of_RSA_in_case_of_RSA_token

    and delta gamma four would be DC 4 or something… I dont knoww greek letters very well.

  22. pr3sidentspence

    It’s Hexadecimal, base 16. It’s like base 10, but the 10th-15th numerals are expressed by the first 6 letters.

    I ran it through a hex to ascii converter but it’s nonsense. It’s basically a really huge number, which is what RSA uses to encrypt and decrypt information.

    -Mike

  23. al

    Oh, and still on. Try search “Cacatrice” from site. Text files, combinations, anything, as it is listed as a project.

  24. Scully Scully

    I googled ‘Cacatrice’ and couldn’t find anything in English.I didn’t try adding that to the address bar though. I will check it out.

  25. Scully Scully

    I checked it out…nothing with ‘Cacatrice’ but there was another file listed under chimera…

    Gryphon-86
    TGAAACGGAGGAGACGTTACAGCAACGT
    TGAAATGGAGGAGAAATTACAGCAATTT
    TGAAACGGAAGAGACGTTACAGCAACGT

    sciref:geep
    refproj:mockt
    refproj:mosaic

    Also, all of the listings on the ‘Error 404′ page are for sedoparking.com. This is more evidence that the website is fake. (but still interesting)

  26. Cockatrice

    I’m such a dork — cactrice should be Cockatrice … it’s a legendary creature like a griffin and whatnot.

    You know, does the Fringe viewing world know for a fact that the cortexifan site is bogus? JJ has used misspellings before as purposeful clues. In the recent magazine Wired which he guest edited, he ladened the thing with all manners of puzzles, etc. One of the puzzles was an Edgar Alan Poe excerpt with intentional misspellings as part of the puzzle.

    It would really be nice to know for sure whether or not this site is a total fraud or not. The multitude of misspellings though is almost too coincidental it would seem.

  27. Di

    i went back to the site to double check if susan pratt [or her initials] could be found on any of the lists as a positive. but i found no SP. that would indicate that it isn’t real because the only initials that match are PB and OD, which we’ve known about [almost] from the get-to. But on defense of the cortexifan possible hoax, we never knew if susan pratt was her real name, as her twin sister had a very different last name. something that also doesn’t make too much sense is that the FBI database said that she’d disappeared 11 years ago, but from where? 11 years ago would leave her twin sister old enough to remember her, had she been with her. and not only remember, but be on the look-out for her, as they lived on the same area. Also both susan and her sister had successfully achieved normal lives with both her names [working, which i'd assume would imply real social security numbers and whatnot]. had she disappeared and been forced to change her identity, that would take a pro to bureaucratically re-build a life from scratch starting from the point of her disappearance, which would possibly also land her, possibly, on her teens..so who was helping her? that bit doesn’t make any sense.

  28. p3sidentspence

    He’s intentionally misspelled things before?

    That makes me think of SURGG and some of the early glyph words.

  29. eph

    Um, why was my comment deleted?

  30. eph

    Reposting…

    X-KR-COR235996 TS42OD83P 1 = Olivia?

    Since you’ve caught on to the law of time calendar on the cortexifan site, check out http://www.lawoftime.org/content/ThirteenMoonsinMotion.pdf.
    In the 13 moon calendar, the number 7 corresponds to the symbol for blue hand (also red blood/heart and transforming remembrance) which, in turn, corresponds to a large area of the pacific ocean. The blue hand knows accomplishment. The number 7 also corresponds to the resonant moon (brought by the resonant monkey) which occurs between January 10th and February 6th. The resonant moon is the moon of attunement: how can I attune my service to others? The galactic enzyme code for the hand is 7,1,8,2,9,3,10,4,11,5,12,6,13.

    This belief system holds that time may be stopped by changing the calendar, and that, if we accomplish this, we will experience an “evolutionary upgrade” in the year 2012 and no longer be homo sapiens. It will be a new beginning, the “coming of heaven on Earth.” The number glyphs and the end of the world as we know it in 2012 are obviously concepts borrowed from the ancient Mayans.

    On the frog on the cortexifan site, his leg is coded with C20H25N3, which is D-Lysergic Acid Diethylamide or LSD.

  31. Di

    i liked the 13 moon thing a lot. i got lost on the gibberish but it all made sense, and i could only fathom that they would include the ‘ending of the world’ [as we know it, as it doesn't mean actual disintegration] from the mayans. but all the esoteric stuff kinda threw me off. but the LSD makes total sense, as, as we know, walter and bell were very fond of it on earlier times.

  32. ariannejean

    @EPH! Do you know when the Cortexifan.com (note that this one is spelled correctly) Became active?

    It doesn’t seem to hold any secrets… just a very simple layout.

  33. ariannejean

    wait, nvm that. lol. that’s the incorrect one.

  34. ariannejean

    the site seems to of given up though and just settled for the simple layout with the frog.

  35. Scully Scully

    Sorry eph: Your comment wasn’t deleted, it was waiting for approval because it had a link in it. I have to do this to avoid spam or the comment box would be filled with links to nude pictures of Pamela Anderson.

  36. Di

    did someone notice that the cortexifan.com site changed?! it’s a black screen now with simple text, that reads:

    “We own the site now.
    Go elsewhere for your information.
    You will find nothing here.”

    that’d be a mock reference to MD i assume :P

  37. ariannejean

    when you go to “view page source” it says

    one is spelled correctly. just thought I’de point that out.

    this is the date of its change: 2009-05-13

  38. Di

    ..or perhaps a reference to ZFT?

  39. Di

    something new on the site..a watermark on the lower left corner that when you hover over it, reads: ‘wbwashere’. how very great that both walter and william are wb’s, it could be anyone. :P

  40. Di

    ok, not a watermark but a glowing frog that fades into a watermark and then glows back to full-blown frog

  41. Di

    http://www.cortexifan.com/frog.gif

    frog has a code on the hind leg..i know i’m posting too much but i keep on finding these things and i can’t erase the previous comments to just put everything together on one. if you guys think it could be of any relevance check it out, i’m officially dropping it now, i promise! lol

  42. ariannejean

    the frogs leg has C2OH25N30 on it. (i think.)

    C2OH25N30- compound of D-Lysergic Acid Diethylamide.
    in other words ( I belive )It’s LSD.

  43. Scully Scully

    No way, that’s awesome work ariannejean. I was kind of disappointed that there was no link on that page…I thought the frog might take us somewhere else. Maybe later on they will add something else to it.

  44. Andrew

    I dunno if this is new, but if you go to http://www.cortexifan.com, it says:

    “We own the site now.
    Go elsewhere for your information.

    You will find nothing here.”

    Creepy.

  45. Andrew

    Oh… it was already found. >_< Duh.

  46. Di

    @Andrew, on my comment on May 14th i pointed out that the msg had changed, but then, the frog wasn’t there. i went back yesterday to see if anything had changed and there was the smudge on the corner, than turned into a frog.

    @ariannejean, i downloaded the set of imgs after that last post and extracted the code, but i said i wasn’t posting again, so i just let it roll :P but yes, that is indeed LSD [see http://en.wikipedia.org/wiki/Lsd

  47. Edgar Holzmiller

    Congratulations on your prolific work here. I must admit I have popped in a read a good number of your blogs but I have no idea how to post a response over there, so I’ll tell you now how good you are at describing the stuff your at - I must admit I find it insightful to read your blogging. Keep up the good work. :)

Leave a Reply